Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of the loss-of-function metastasis screen using the mouse genome-scale CRISPR/Cas9 knock-out library (mGeCKOa).

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: CRISPR, Knock-Out

Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of lentiviral transduction of Cas9-GFP KPD cells with single sgRNAs designed to target one gene or miR. After puromycin selection, the cell population was transplanted into Nu/Nu mice and also deep sequenced to examine the distribution of indels at the target site. After 5 weeks, the primary tumor and lungs are examined.

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: Transduction, Selection

Journal: Cell reports

Article Title: CRISPR-Cas9 screening identifies an IRF1-SOCS1-mediated negative feedback loop that limits CXCL9 expression and antitumor immunity.

doi: 10.1016/j.celrep.2023.113014

Figure Lengend Snippet: Figure 5. Targeting SOCS1 in macrophages enhances CXCL9 expression CRISPR-Cas9 editing was used to generate control or Irf1- or Socs1-deficient bone marrow-derived macrophages as per Figure 3E. 1 3 105 macrophages were stimulated for 17 h with 1 ng/mL IFNg. (A and B) Expression of Cxcl9 determined (A) by flow cytometry and (B) by cytometric bead array. *p < 0.05, ****p < 0.0001, two-way ANOVA. (C) MA plot of RNA-seq analysis performed on control and Socs1 KO bone marrow-derived macrophages stimulated with 1 ng/mL IFNg for 17 h.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Raw data This paper GSE237974 Murine scRNA sequencing data Qu et al.6 GSE150970 Human scRNA sequencing data Bassez et al.29 EGAS00001004809 STAT1 CHIPseq Hogg et al.28 GSE94134 Experimental models: Cell lines Mouse: AT-3 Trina Stewart N/A Mouse: E0771 Robin Anderson N/A Mouse: B16F10 ATCC CRL-6475 Human: OVCAR-3 ATCC HTB-161 Human: MCF7 ATCC HTB-22 Human: HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Human-Her2 (hHer2) Bred in house N/A Mouse: OTI Bred in house N/A Mouse: C57BL/6 WEHI N/A Mouse: C57BL/6 Rag1 / WEHI, Australian Bioresources N/A Mouse: Ly5.1 WEHI, Australian Bioresources N/A Oligonucleotides See Table S3 for sgRNA Sequences Synthego N/A See Table S4 for Primer Sequences Integrated DNA Technologies N/A Recombinant DNA Plasmid: FUCas9Cherry Aubrey et al.45 Addgene Plasmid:70182 Pooled library: Mouse CRISPR Knockout Pooled Library (Brie) Doench et al.46 Addgene Cat:73633 Pooled library: Mouse CRISPR Knockout Pooled Library (Gecko) Sanjana et al.47 Plasmid: pMDLg/pRRE Dull et al.48 Addgene Plasmid:12251 Plasmid: pRSV-Rev Dull et al.48 Addgene Plasmid:12253 Plasmid: pMD2.G Dider Trono: Trono Laboratory Packaging and Envelope Plasmids (unpublished) Addgene Plasmid:12259 Homology repair template: Cxcl9-GFP Knock In (See Table S5 for sequence) This Paper N/A Homology repair template: BFP into Irf1 Knock In (See Table S5 for sequence) This Paper N/A Homology repair template: Irf1 + BFP into Irf1 Knock In (See Table S5 for sequence) This Paper N/A Software and algorithms CutAdapt Martin.49 https://cutadapt.readthedocs.io/en/stable/ MAGeCK v0.5.7 Li et al.50 https://sourceforge.net/projects/mageck/ RNASeQC DeLuca et al.51 www.broadinstitute.org/rna-seqc/ HISAT2 Kim et al.52 https://github.com/DaehwanKimLab/ hisat2 EdgeR v3.8.5 Robinson, McCarthy, and Smyth53 McCarthy, Chen, and Smyth54 https://bioconductor.org/packages/ release/bioc/html/edgeR.html Seurat v4.0.4 Stuart et al.55 https://github.com/satijalab/seurat/ releases/tag/v4.0.4 GENIE3 v1.16.0 Huynh-Thu et al.56 https://github.com/vahuynh/GENIE3 Bowtie2 v2.3.3 Langmead et al.57 https://bowtie-bio.sourceforge.net/index. shtml (Continued on next page) Cell Reports 42, 113014, August 29, 2023 19

Techniques: Expressing, CRISPR, Control, Derivative Assay, Cytometry, RNA Sequencing

Journal: medRxiv

Article Title: Targeting the Coronavirus Nucleocapsid Protein through GSK-3 Inhibition

doi: 10.1101/2021.02.17.21251933

Figure Lengend Snippet: A. Control 293T cells ( WT ), 293T cells with CRISPR/Cas9 KO of GSK3A ( GSK3A -/- ), and GSK3A -/- cells with siRNA knockdown of GSK3B ( GSK3A -/-- ;siGSK3 B ) were treated with LiCl at indicated concentrations and lysates were immunoblotted for N protein, phospho-β-catenin, GSK-3α/β, or β-Actin. Combined loss of GSKA and GSK3B impairs phosphorylation of N and β-catenin and enhances sensitivity to LiCl. B. GSK3B was deleted in GSK3A -/- cells using CRISPR ( GSK3 DKO). N protein was expressed in both wild-type and DKO cells in the presence of increasing concentrations LiC for 18h as above and immunoblotted for N protein, phospho-GS (pGS), total β-catenin, GSK-3α/β, and β-actin. N is not phosphorylated in DKO cells and mobility is not affected by LiCl treatment. Total β− catenin protein accumulates in absence of GSK-3 (DKO) or upon inhibition with LiCl. C. Serine-188 and serine-206 were mutated to alanine by site directed mutagenesis and single and double mutant N proteins were expressed in 293T cells in the presence of vehicle or 10mM LiCl and immunoblotted for N protein, pGS, or β-actin. The double mutant N S188A;S206A migrates similar to dephosphorylated wild-type N. Single mutants are more sensitive to LiCl. D/E. N protein was immunoprecipitated from wild-type HEK293T cells treated with or without 10mM LiCl for 18h (indicated by “Ctl” or “LiCl” below each lane in panel D) or from GSK3 DKO cells (panel E). Immunoprecipitated N protein was added to an in vitro kinase reaction with recombinant GSK-3β.GSK-3β phosphorylates N from LiCl treated wild-type and DKO cells as indicated by slower electroporetic mobility (“phos” in panel E). F. N protein immunoprecipitated from DKO cells was added to an in vitro kinase reaction with recombinant GSK-3β as in panel E except that γ - 32 P-ATP was included and gels were fixed, dried, and exposed to X-ray film.

Article Snippet: For CRISPR/Cas9 knockout, guide RNA (gRNA) sequence targeting GSK-3A (GCCTAGAGTGGCTACGACTG) or GSK-3B (AGATGAGGTCTATCTTAATC) was cloned into lentiCRISPRv2 vector (Addgene #99154, Sanjana et al. 2014).

Techniques: CRISPR, Inhibition, Mutagenesis, Immunoprecipitation, In Vitro, Recombinant